Transcript: Human NM_001285440.2

Homo sapiens RPTOR independent companion of MTOR complex 2 (RICTOR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
RICTOR (253260)
Length:
9417
CDS:
876..5033

Additional Resources:

NCBI RefSeq record:
NM_001285440.2
NBCI Gene record:
RICTOR (253260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001285440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074289 CGGAGGTTCATACAAGAATTA pLKO.1 4914 CDS 100% 13.200 18.480 N RICTOR n/a
2 TRCN0000289691 CGGAGGTTCATACAAGAATTA pLKO_005 4914 CDS 100% 13.200 18.480 N RICTOR n/a
3 TRCN0000074291 CGTCGGAGTAACCAAAGATTA pLKO.1 2613 CDS 100% 13.200 18.480 N RICTOR n/a
4 TRCN0000307119 CGTCGGAGTAACCAAAGATTA pLKO_005 2613 CDS 100% 13.200 18.480 N RICTOR n/a
5 TRCN0000074288 CCGCAGTTACTGGTACATGAA pLKO.1 5155 3UTR 100% 4.950 6.930 N RICTOR n/a
6 TRCN0000307122 CCGCAGTTACTGGTACATGAA pLKO_005 5155 3UTR 100% 4.950 6.930 N RICTOR n/a
7 TRCN0000074292 CCCTAATGAATATGGCTGCAT pLKO.1 1372 CDS 100% 2.640 3.696 N RICTOR n/a
8 TRCN0000296313 CCGATCATGGGCAGGTATTAT pLKO_005 896 CDS 100% 15.000 12.000 N RICTOR n/a
9 TRCN0000074290 GCACCCTCTATTGCTACAATT pLKO.1 3933 CDS 100% 13.200 9.240 N RICTOR n/a
10 TRCN0000289690 GCACCCTCTATTGCTACAATT pLKO_005 3933 CDS 100% 13.200 9.240 N RICTOR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285440.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.