Transcript: Mouse NM_001285861.1

Mus musculus synaptotagmin VIII (Syt8), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Syt8 (55925)
Length:
1382
CDS:
100..1287

Additional Resources:

NCBI RefSeq record:
NM_001285861.1
NBCI Gene record:
Syt8 (55925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093221 GAGTCCTCTTAGTCTCCTGTT pLKO.1 257 CDS 100% 4.050 5.670 N Syt8 n/a
2 TRCN0000093223 CCTCCAAGAAAGGCACGACTA pLKO.1 980 CDS 100% 4.050 3.240 N Syt8 n/a
3 TRCN0000093220 GCTGTCACTAGAGTATGATTT pLKO.1 453 CDS 100% 13.200 9.240 N Syt8 n/a
4 TRCN0000381614 GGGAGAAGACATGAGACAAAG pLKO_005 574 CDS 100% 10.800 7.560 N Syt8 n/a
5 TRCN0000380460 TCCTGCTGTCACTAGAGTATG pLKO_005 449 CDS 100% 10.800 7.560 N Syt8 n/a
6 TRCN0000381257 TCTGTGTCATCTGTTGCTATT pLKO_005 281 CDS 100% 10.800 7.560 N Syt8 n/a
7 TRCN0000093219 GCTTATGTTAAACCAGAGAAA pLKO.1 939 CDS 100% 4.950 3.465 N Syt8 n/a
8 TRCN0000380906 TTGGAAGCCAGGAGATTAGAG pLKO_005 473 CDS 100% 4.950 3.465 N Syt8 n/a
9 TRCN0000093222 CCCAGGGAAGTGGATCGTGTT pLKO.1 1222 CDS 100% 1.350 0.945 N Syt8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.