Transcript: Mouse NM_001285875.1

Mus musculus platelet-activating factor acetylhydrolase 2 (Pafah2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pafah2 (100163)
Length:
3086
CDS:
414..1226

Additional Resources:

NCBI RefSeq record:
NM_001285875.1
NBCI Gene record:
Pafah2 (100163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001285875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110990 CGCTGCATAAATCGCATAAAT pLKO.1 2791 3UTR 100% 15.000 21.000 N Pafah2 n/a
2 TRCN0000305907 CTTTATCAACGTCGAGAAATT pLKO_005 881 CDS 100% 13.200 18.480 N Pafah2 n/a
3 TRCN0000305970 GGCTGATTGGGAAGCGGATTT pLKO_005 1369 3UTR 100% 10.800 15.120 N Pafah2 n/a
4 TRCN0000110992 GCGCTGTTCATCGGAGTCAAA pLKO.1 979 CDS 100% 4.950 6.930 N Pafah2 n/a
5 TRCN0000325237 GCGCTGTTCATCGGAGTCAAA pLKO_005 979 CDS 100% 4.950 6.930 N Pafah2 n/a
6 TRCN0000110994 CGATCAATGGAGCAGCTTCAT pLKO.1 1148 CDS 100% 4.950 3.960 N Pafah2 n/a
7 TRCN0000325313 CGATCAATGGAGCAGCTTCAT pLKO_005 1148 CDS 100% 4.950 3.960 N Pafah2 n/a
8 TRCN0000110991 CCGCACTATCTGTCTAGTCTA pLKO.1 1203 CDS 100% 4.950 3.465 N Pafah2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001285875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.