Transcript: Human NM_001286109.2

Homo sapiens CLN3 lysosomal/endosomal transmembrane protein, battenin (CLN3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
CLN3 (1201)
Length:
1783
CDS:
399..1481

Additional Resources:

NCBI RefSeq record:
NM_001286109.2
NBCI Gene record:
CLN3 (1201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083019 GTAGTTTACTTTGCCGAGTAT pLKO.1 1032 CDS 100% 4.950 6.930 N CLN3 n/a
2 TRCN0000083018 CGTAGTTTACTTTGCCGAGTA pLKO.1 1031 CDS 100% 4.050 5.670 N CLN3 n/a
3 TRCN0000290462 CGTAGTTTACTTTGCCGAGTA pLKO_005 1031 CDS 100% 4.050 5.670 N CLN3 n/a
4 TRCN0000296574 ACCTCGTCTTCCTGATCATTC pLKO_005 1279 CDS 100% 10.800 7.560 N CLN3 n/a
5 TRCN0000083021 GCTATTTCTTGTTGCTCACAT pLKO.1 841 CDS 100% 4.950 3.465 N CLN3 n/a
6 TRCN0000290460 GCTATTTCTTGTTGCTCACAT pLKO_005 841 CDS 100% 4.950 3.465 N CLN3 n/a
7 TRCN0000308269 TCAGGACGCAGGTCACATTCA pLKO_005 1494 3UTR 100% 4.950 3.465 N CLN3 n/a
8 TRCN0000083022 CAACTTCTCTTATGTGGTGAT pLKO.1 380 5UTR 100% 4.050 2.835 N CLN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286109.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.