Transcript: Human NM_001286254.2

Homo sapiens kelch like family member 32 (KLHL32), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Homo sapiens (human)
Gene:
KLHL32 (114792)
Length:
2765
CDS:
823..1293

Additional Resources:

NCBI RefSeq record:
NM_001286254.2
NBCI Gene record:
KLHL32 (114792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145334 GCTTCCTTGTCTTGCTTTATA pLKO.1 1373 3UTR 100% 15.000 10.500 N KLHL32 n/a
2 TRCN0000122442 GCTGTCCATAATGGGAGAATA pLKO.1 1057 CDS 100% 13.200 9.240 N KLHL32 n/a
3 TRCN0000121810 GCGAACACTTTGTAATACTTT pLKO.1 1990 3UTR 100% 5.625 3.938 N KLHL32 n/a
4 TRCN0000143709 GCATGTGAAAGAGACACACAA pLKO.1 2160 3UTR 100% 4.950 3.465 N KLHL32 n/a
5 TRCN0000145448 GCTAATGGTGTATGAACCTAA pLKO.1 819 5UTR 100% 4.950 3.465 N KLHL32 n/a
6 TRCN0000142745 CCAGAAGAAGTTCTAACGCTT pLKO.1 692 5UTR 100% 2.640 1.848 N KLHL32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286254.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.