Transcript: Mouse NM_001286343.1

Mus musculus B cell leukemia/lymphoma 11B (Bcl11b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Bcl11b (58208)
Length:
7341
CDS:
272..2344

Additional Resources:

NCBI RefSeq record:
NM_001286343.1
NBCI Gene record:
Bcl11b (58208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238422 TACTGGCAAGGCGGAATATTT pLKO_005 6943 3UTR 100% 15.000 21.000 N Bcl11b n/a
2 TRCN0000096234 CGGTGAACACTTGCTGACTAA pLKO.1 2290 CDS 100% 4.950 6.930 N Bcl11b n/a
3 TRCN0000414002 CATGAAGACGCACGGGCAGAT pLKO_005 2185 CDS 100% 1.350 1.890 N BCL11B n/a
4 TRCN0000244249 TGAGAGGAGCTAAGCGCATAC pLKO_005 2332 CDS 100% 6.000 4.800 N Bcl11b n/a
5 TRCN0000096236 GTCGGAACATTCCTCTGAGAA pLKO.1 1879 CDS 100% 4.950 3.960 N Bcl11b n/a
6 TRCN0000238420 TGAGCCTTCCAGCTACATTTG pLKO_005 337 CDS 100% 10.800 7.560 N Bcl11b n/a
7 TRCN0000238421 AGATGCCCTTCAGCGTCTACA pLKO_005 2238 CDS 100% 4.950 3.465 N Bcl11b n/a
8 TRCN0000238419 CAAGTTCCAGAGCAATCTCAT pLKO_005 994 CDS 100% 4.950 3.465 N Bcl11b n/a
9 TRCN0000033479 CCAGCTACATTTGCACAACAT pLKO.1 345 CDS 100% 4.950 3.465 N BCL11B n/a
10 TRCN0000429728 AGTTCCAGAGCAATCTCATCG pLKO_005 996 CDS 100% 4.050 2.835 N BCL11B n/a
11 TRCN0000441656 AGTCGAGCTTCAGCATGGACT pLKO_005 1338 CDS 100% 2.640 1.848 N BCL11B n/a
12 TRCN0000436190 CCAGATGCCCTTCAGCGTCTA pLKO_005 2236 CDS 100% 1.350 0.945 N BCL11B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.