Transcript: Mouse NM_001286344.1

Mus musculus par-6 family cell polarity regulator alpha (Pard6a), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pard6a (56513)
Length:
1266
CDS:
605..1117

Additional Resources:

NCBI RefSeq record:
NM_001286344.1
NBCI Gene record:
Pard6a (56513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294865 CTCTACAAAGGCGCAAGAAAG pLKO_005 402 5UTR 100% 10.800 15.120 N Pard6a n/a
2 TRCN0000113075 CCTGCCAACCAGCGTAATAAT pLKO.1 818 CDS 100% 15.000 10.500 N Pard6a n/a
3 TRCN0000298330 CCTGCCAACCAGCGTAATAAT pLKO_005 818 CDS 100% 15.000 10.500 N Pard6a n/a
4 TRCN0000294796 TGGACGTCCTGCTTGGCTATA pLKO_005 240 5UTR 100% 10.800 7.560 N Pard6a n/a
5 TRCN0000113078 CCTCACCAACGATGACAGTTT pLKO.1 286 5UTR 100% 4.950 3.465 N Pard6a n/a
6 TRCN0000113077 GTTATAGATGTGGACCTACTA pLKO.1 509 5UTR 100% 4.950 3.465 N Pard6a n/a
7 TRCN0000113079 GCGGTCAGTGATGAGATCCTT pLKO.1 704 CDS 100% 3.000 2.100 N Pard6a n/a
8 TRCN0000298329 GCGGTCAGTGATGAGATCCTT pLKO_005 704 CDS 100% 3.000 2.100 N Pard6a n/a
9 TRCN0000113076 GCCACCCTTGTTAATCAGCTT pLKO.1 460 5UTR 100% 2.640 1.848 N Pard6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.