Transcript: Mouse NM_001286370.1

Mus musculus growth hormone receptor (Ghr), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Mus musculus (mouse)
Gene:
Ghr (14600)
Length:
4003
CDS:
64..2016

Additional Resources:

NCBI RefSeq record:
NM_001286370.1
NBCI Gene record:
Ghr (14600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349024 ATGCCCAAGTAAGCGACATTA pLKO_005 1556 CDS 100% 13.200 18.480 N Ghr n/a
2 TRCN0000067228 CCCGACTTCTACAATGATGAT pLKO.1 1090 CDS 100% 4.950 6.930 N Ghr n/a
3 TRCN0000301487 CCCGACTTCTACAATGATGAT pLKO_005 1090 CDS 100% 4.950 6.930 N Ghr n/a
4 TRCN0000349000 CAGCGAAGTCCTCCGTGTAAT pLKO_005 816 CDS 100% 13.200 9.240 N Ghr n/a
5 TRCN0000304282 GAAATTGAATGCAGATTATAG pLKO_005 2368 3UTR 100% 13.200 9.240 N Ghr n/a
6 TRCN0000067232 GCTTTAACCAAGAGGACATTT pLKO.1 1772 CDS 100% 13.200 9.240 N Ghr n/a
7 TRCN0000067229 CCCACATCACTGGCAAACATT pLKO.1 1528 CDS 100% 5.625 3.938 N Ghr n/a
8 TRCN0000067231 GCTGCAAGAATTGCTCATGAA pLKO.1 346 CDS 100% 4.950 3.465 N Ghr n/a
9 TRCN0000301486 GCTGCAAGAATTGCTCATGAA pLKO_005 346 CDS 100% 4.950 3.465 N Ghr n/a
10 TRCN0000067230 GCTTTGCCTTTGCCTGACAAA pLKO.1 1933 CDS 100% 4.950 3.465 N Ghr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286370.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.