Transcript: Human NM_001286375.2

Homo sapiens integrin subunit alpha X (ITGAX), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ITGAX (3687)
Length:
4092
CDS:
80..3589

Additional Resources:

NCBI RefSeq record:
NM_001286375.2
NBCI Gene record:
ITGAX (3687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029045 GCCACGAACAATTCACCAAAT pLKO.1 2868 CDS 100% 10.800 15.120 N ITGAX n/a
2 TRCN0000029048 GCCTTTACATTGACAAACGTT pLKO.1 2043 CDS 100% 3.000 4.200 N ITGAX n/a
3 TRCN0000430048 CGATTGTTCCATGCCTCATAT pLKO_005 791 CDS 100% 13.200 10.560 N ITGAX n/a
4 TRCN0000429229 AGGCGACAGCCTGGATTATAA pLKO_005 868 CDS 100% 15.000 10.500 N ITGAX n/a
5 TRCN0000419139 AGCAGTAGCTCCTTCGAATTG pLKO_005 1106 CDS 100% 10.800 7.560 N ITGAX n/a
6 TRCN0000029046 GCGTCAGTACAAGGAAATGAT pLKO.1 3481 CDS 100% 5.625 3.938 N ITGAX n/a
7 TRCN0000426006 TGATGCAGTTCTCCAACAAAT pLKO_005 648 CDS 100% 13.200 7.920 N ITGAX n/a
8 TRCN0000029047 CCCAAATATGAGCCCTACCTT pLKO.1 1228 CDS 100% 3.000 1.800 N ITGAX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.