Transcript: Mouse NM_001286421.1

Mus musculus otoferlin (Otof), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Otof (83762)
Length:
7065
CDS:
135..6068

Additional Resources:

NCBI RefSeq record:
NM_001286421.1
NBCI Gene record:
Otof (83762)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104953 CGCAATGAGAATGATGAGTTT pLKO.1 5757 CDS 100% 4.950 6.930 N Otof n/a
2 TRCN0000104952 CCTCCCTGATTCACAATTATA pLKO.1 3637 CDS 100% 15.000 12.000 N Otof n/a
3 TRCN0000424854 GCGCAAGCCCTGCATCTATAT pLKO_005 2252 CDS 100% 13.200 10.560 N Otof n/a
4 TRCN0000429564 ACGGTGAAGCTCACGAGTTAC pLKO_005 3187 CDS 100% 10.800 8.640 N Otof n/a
5 TRCN0000104950 CCAGTGAAATTAACCAAGAAA pLKO.1 6599 3UTR 100% 5.625 3.938 N Otof n/a
6 TRCN0000104951 GCCTCAATGATTGACCGGAAA pLKO.1 1986 CDS 100% 4.050 2.430 N Otof n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.