Transcript: Mouse NM_001286469.1

Mus musculus X-linked Kx blood group related 5 (Xkr5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Xkr5 (319581)
Length:
3928
CDS:
1146..3146

Additional Resources:

NCBI RefSeq record:
NM_001286469.1
NBCI Gene record:
Xkr5 (319581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257617 GTGTGCATCGCTGGTTATTTA pLKO_005 2036 CDS 100% 15.000 21.000 N Xkr5 n/a
2 TRCN0000247221 TCCCTTGAGGCAACGTATATA pLKO_005 3563 3UTR 100% 15.000 21.000 N Xkr5 n/a
3 TRCN0000216773 GCTTAATCAGCTGCACTATTA pLKO.1 3636 3UTR 100% 13.200 18.480 N Xkr5 n/a
4 TRCN0000247220 GGTTCTGTTCTGCCGAGTTTA pLKO_005 1706 CDS 100% 13.200 18.480 N Xkr5 n/a
5 TRCN0000247219 TGAGCTAACAAGTCTAGATAA pLKO_005 2222 CDS 100% 13.200 18.480 N Xkr5 n/a
6 TRCN0000217398 GAGCTAACAAGTCTAGATAAG pLKO.1 2223 CDS 100% 10.800 15.120 N Xkr5 n/a
7 TRCN0000173834 CGTGGCCAATATTAGTCCCAT pLKO.1 2891 CDS 100% 2.640 3.696 N Xkr5 n/a
8 TRCN0000247218 CTGTTACCGTGGCCAATATTA pLKO_005 2884 CDS 100% 15.000 10.500 N Xkr5 n/a
9 TRCN0000173968 GCTGGAGAACTCCATACTCTT pLKO.1 1931 CDS 100% 4.950 3.465 N Xkr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.