Transcript: Human NM_001286513.1

Homo sapiens solute carrier family 35 member B2 (SLC35B2), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
SLC35B2 (347734)
Length:
1929
CDS:
286..1305

Additional Resources:

NCBI RefSeq record:
NM_001286513.1
NBCI Gene record:
SLC35B2 (347734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044953 CCAGCTATGGTTCTTCCGATT pLKO.1 257 5UTR 100% 4.050 5.670 N SLC35B2 n/a
2 TRCN0000044957 TGGTGCCAATACGAAGCTCTT pLKO.1 598 CDS 100% 4.050 5.670 N SLC35B2 n/a
3 TRCN0000430930 CATCTTCCAGTAAGCAGTTTA pLKO_005 1488 3UTR 100% 13.200 9.240 N SLC35B2 n/a
4 TRCN0000417879 CATCGGTGCAGATGATGTTTG pLKO_005 899 CDS 100% 10.800 7.560 N SLC35B2 n/a
5 TRCN0000430215 GCATAGGTAGGTTCCAGTTAC pLKO_005 1571 3UTR 100% 10.800 7.560 N SLC35B2 n/a
6 TRCN0000421129 AGAGTGATGACCCGCAGCTAT pLKO_005 400 CDS 100% 4.950 3.465 N SLC35B2 n/a
7 TRCN0000044954 CCTCATCTTACTGGCAGGTTA pLKO.1 819 CDS 100% 4.950 3.465 N SLC35B2 n/a
8 TRCN0000044955 CCTTCTTTCCTGCCTTCTCTA pLKO.1 1143 CDS 100% 4.950 2.970 N SLC35B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.