Transcript: Mouse NM_001286546.1

Mus musculus cell cycle progression 1 (Ccpg1), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ccpg1 (72278)
Length:
3019
CDS:
466..2427

Additional Resources:

NCBI RefSeq record:
NM_001286546.1
NBCI Gene record:
Ccpg1 (72278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277458 GAGTTTGTGAGACATCATAAA pLKO_005 1666 CDS 100% 13.200 18.480 N Ccpg1 n/a
2 TRCN0000176972 GATTCGGATATTGTTACACTT pLKO.1 492 CDS 100% 4.950 6.930 N Ccpg1 n/a
3 TRCN0000182218 CCCGTTCTTTATGTAGGGCAT pLKO.1 330 5UTR 100% 2.160 3.024 N Ccpg1 n/a
4 TRCN0000182275 GAGCCAAGTAAACGCCACTTT pLKO.1 781 CDS 100% 4.950 3.960 N Ccpg1 n/a
5 TRCN0000277530 GAGCCAAGTAAACGCCACTTT pLKO_005 781 CDS 100% 4.950 3.960 N Ccpg1 n/a
6 TRCN0000177559 CCATTTCAAAGATACTACCAA pLKO.1 1764 CDS 100% 3.000 2.400 N Ccpg1 n/a
7 TRCN0000197379 CCAGGAAGTTACAATTCAAGA pLKO.1 542 CDS 100% 4.950 3.465 N Ccpg1 n/a
8 TRCN0000182755 CCAGGTCCTTAAGCAGTACTT pLKO.1 1215 CDS 100% 4.950 3.465 N Ccpg1 n/a
9 TRCN0000277527 CCAGGTCCTTAAGCAGTACTT pLKO_005 1215 CDS 100% 4.950 3.465 N Ccpg1 n/a
10 TRCN0000182637 GCAAGCAGGAACAAGAGTCTT pLKO.1 956 CDS 100% 4.950 3.465 N Ccpg1 n/a
11 TRCN0000277523 GCAAGCAGGAACAAGAGTCTT pLKO_005 956 CDS 100% 4.950 3.465 N Ccpg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.