Transcript: Human NM_001286582.2

Homo sapiens PHD and ring finger domains 1 (PHRF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PHRF1 (57661)
Length:
5533
CDS:
145..5088

Additional Resources:

NCBI RefSeq record:
NM_001286582.2
NBCI Gene record:
PHRF1 (57661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359826 CAGTTGATCGAACTCTATTTA pLKO_005 578 CDS 100% 15.000 21.000 N PHRF1 n/a
2 TRCN0000359824 ACGACCTGGACCTGGATTATG pLKO_005 3902 CDS 100% 13.200 18.480 N PHRF1 n/a
3 TRCN0000074344 CGGACACGTCTTTGATGATTT pLKO.1 3939 CDS 100% 13.200 18.480 N PHRF1 n/a
4 TRCN0000074345 CGAGCTCAATTTGGTGGTAAA pLKO.1 613 CDS 100% 10.800 15.120 N PHRF1 n/a
5 TRCN0000359825 TTGAGAGCTTCCGGATCAATA pLKO_005 2459 CDS 100% 13.200 9.240 N PHRF1 n/a
6 TRCN0000074347 GCTACCCAGGATACCAAAGAT pLKO.1 2172 CDS 100% 5.625 3.938 N PHRF1 n/a
7 TRCN0000074346 GCACTATGAGAGTAGGAAGAA pLKO.1 3444 CDS 100% 4.950 3.465 N PHRF1 n/a
8 TRCN0000074343 CCTGTGTTGCTCACAGTTGAA pLKO.1 5274 3UTR 100% 0.495 0.347 N PHRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.