Transcript: Mouse NM_001286652.1

Mus musculus transmembrane protein 176B (Tmem176b), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tmem176b (65963)
Length:
1181
CDS:
148..939

Additional Resources:

NCBI RefSeq record:
NM_001286652.1
NBCI Gene record:
Tmem176b (65963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105306 CCCTACTACGTCGAGATCTTT pLKO.1 598 CDS 100% 5.625 7.875 N Tmem176b n/a
2 TRCN0000302626 CCCTACTACGTCGAGATCTTT pLKO_005 598 CDS 100% 5.625 7.875 N Tmem176b n/a
3 TRCN0000105307 TGGGACTAAGTCTCCGAAGTA pLKO.1 806 CDS 100% 4.950 6.930 N Tmem176b n/a
4 TRCN0000105305 CGTGTCCCTGTCCATAGTAAT pLKO.1 954 3UTR 100% 13.200 10.560 N Tmem176b n/a
5 TRCN0000302552 CGTGTCCCTGTCCATAGTAAT pLKO_005 954 3UTR 100% 13.200 10.560 N Tmem176b n/a
6 TRCN0000105308 GTACCTGAACATGATGATGAA pLKO.1 714 CDS 100% 0.000 0.000 N Tmem176b n/a
7 TRCN0000302625 GTACCTGAACATGATGATGAA pLKO_005 714 CDS 100% 0.000 0.000 N Tmem176b n/a
8 TRCN0000105309 CAGTGCGATACAGTGATGATT pLKO.1 665 CDS 100% 5.625 3.375 N Tmem176b n/a
9 TRCN0000302624 CAGTGCGATACAGTGATGATT pLKO_005 665 CDS 100% 5.625 3.375 N Tmem176b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.