Transcript: Human NM_001286711.1

Homo sapiens acyl-CoA synthetase long chain family member 1 (ACSL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ACSL1 (2180)
Length:
3773
CDS:
232..2226

Additional Resources:

NCBI RefSeq record:
NM_001286711.1
NBCI Gene record:
ACSL1 (2180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423108 ACCGGATGTTTGACCGAATTT pLKO_005 1241 CDS 100% 13.200 18.480 N ACSL1 n/a
2 TRCN0000420708 GATGGTGATCGTTCCACTTTA pLKO_005 642 CDS 100% 13.200 18.480 N ACSL1 n/a
3 TRCN0000045522 GCCAAATGTATTTCAGGGCTA pLKO.1 1665 CDS 100% 2.160 3.024 N ACSL1 n/a
4 TRCN0000045519 CGCAGATAGATGACCTCTATT pLKO.1 2189 CDS 100% 1.320 1.056 N ACSL1 n/a
5 TRCN0000427576 CACATTGCACCCTGAATTATT pLKO_005 2097 CDS 100% 15.000 10.500 N ACSL1 n/a
6 TRCN0000423437 TTGAGACTTCCTCAGTTTAAA pLKO_005 2500 3UTR 100% 15.000 10.500 N ACSL1 n/a
7 TRCN0000045518 GCCCAGATGATACTTTGATAT pLKO.1 1061 CDS 100% 13.200 9.240 N ACSL1 n/a
8 TRCN0000045520 CCCTTGGTGTATTTCTATGAT pLKO.1 472 CDS 100% 5.625 3.938 N ACSL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286711.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.