Transcript: Mouse NM_001286727.1

Mus musculus tripartite motif-containing 26 (Trim26), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Trim26 (22670)
Length:
3199
CDS:
231..1868

Additional Resources:

NCBI RefSeq record:
NM_001286727.1
NBCI Gene record:
Trim26 (22670)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339481 GTACATTGTGGCGGAATTTAA pLKO_005 788 CDS 100% 15.000 21.000 N Trim26 n/a
2 TRCN0000339479 ACTGTCACCCTATCCATATAT pLKO_005 2100 3UTR 100% 15.000 12.000 N Trim26 n/a
3 TRCN0000339478 CCAAGGGAGAAGCTGATATTC pLKO_005 733 CDS 100% 13.200 9.240 N Trim26 n/a
4 TRCN0000339480 CTGAGAGACTTGGAGTATAAG pLKO_005 1161 CDS 100% 13.200 9.240 N Trim26 n/a
5 TRCN0000040965 GCCAAGGGAGAAGCTGATATT pLKO.1 732 CDS 100% 13.200 9.240 N Trim26 n/a
6 TRCN0000040964 GCCATCCCTCACATGGTTAAA pLKO.1 1068 CDS 100% 13.200 9.240 N Trim26 n/a
7 TRCN0000339482 TCGCAGCTGCACAAGTGATAT pLKO_005 338 CDS 100% 13.200 9.240 N Trim26 n/a
8 TRCN0000040967 CCAGGAGAAGCTACACTACTA pLKO.1 545 CDS 100% 4.950 3.465 N Trim26 n/a
9 TRCN0000040963 GCAGTACATTGTGGCGGAATT pLKO.1 785 CDS 100% 0.000 0.000 N Trim26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.