Transcript: Mouse NM_001286728.1

Mus musculus glucocorticoid induced transcript 1 (Glcci1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Glcci1 (170772)
Length:
5528
CDS:
176..1231

Additional Resources:

NCBI RefSeq record:
NM_001286728.1
NBCI Gene record:
Glcci1 (170772)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423020 CAAAGTAGTCGGCATAGTAAA pLKO_005 323 CDS 100% 13.200 18.480 N Glcci1 n/a
2 TRCN0000216120 CTATGCCTCTGTCAAACATAT pLKO.1 423 CDS 100% 13.200 18.480 N Glcci1 n/a
3 TRCN0000182894 CCGACTTATATTCAGCAGTTT pLKO.1 1384 3UTR 100% 4.950 6.930 N Glcci1 n/a
4 TRCN0000417892 CAGTATGAATAAGCTCTATTT pLKO_005 1525 3UTR 100% 13.200 10.560 N Glcci1 n/a
5 TRCN0000183057 CGCTCTAAATAGTGGTCATAT pLKO.1 3874 3UTR 100% 13.200 10.560 N Glcci1 n/a
6 TRCN0000144523 CTCAGGTAACTTGGAATGTAT pLKO.1 1755 3UTR 100% 5.625 4.500 N GLCCI1 n/a
7 TRCN0000179036 CGTTACCCAAGTATGCTTCAT pLKO.1 783 CDS 100% 4.950 3.960 N Glcci1 n/a
8 TRCN0000178861 CCATGGCAACCACATAACAAT pLKO.1 367 CDS 100% 5.625 3.938 N Glcci1 n/a
9 TRCN0000183056 CACTCAGAACTATGTGATGAT pLKO.1 1207 CDS 100% 4.950 3.465 N Glcci1 n/a
10 TRCN0000178742 CAAGTATGCTTCATCTCCCAA pLKO.1 790 CDS 100% 2.640 1.848 N Glcci1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.