Transcript: Mouse NM_001286959.1

Mus musculus serine palmitoyltransferase, small subunit B (Sptssb), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sptssb (66183)
Length:
1567
CDS:
189..374

Additional Resources:

NCBI RefSeq record:
NM_001286959.1
NBCI Gene record:
Sptssb (66183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193610 GCTCTATTATCAATACCAGAT pLKO.1 224 CDS 100% 4.050 5.670 N Sptssb n/a
2 TRCN0000175958 GCTCCAGTTAAAGGCTTTGAT pLKO.1 1153 3UTR 100% 5.625 4.500 N Sptssb n/a
3 TRCN0000173980 GCCTGGAGTATGAGATAGGTT pLKO.1 362 CDS 100% 3.000 2.400 N Sptssb n/a
4 TRCN0000215517 GACATGACAAAGTCATATTTA pLKO.1 545 3UTR 100% 15.000 10.500 N Sptssb n/a
5 TRCN0000193647 CATACTGACCATTGTGGCTAT pLKO.1 299 CDS 100% 4.050 2.835 N Sptssb n/a
6 TRCN0000193856 CAACACCATCATACTGACCAT pLKO.1 290 CDS 100% 2.640 1.848 N Sptssb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.