Transcript: Human NM_001286974.2

Homo sapiens catenin alpha like 1 (CTNNAL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CTNNAL1 (8727)
Length:
2491
CDS:
58..2214

Additional Resources:

NCBI RefSeq record:
NM_001286974.2
NBCI Gene record:
CTNNAL1 (8727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415250 GTCGATTGTTACGACACATAT pLKO_005 1409 CDS 100% 13.200 18.480 N CTNNAL1 n/a
2 TRCN0000424778 TGGCAGACCGAGTAGTCATTA pLKO_005 530 CDS 100% 13.200 18.480 N CTNNAL1 n/a
3 TRCN0000117276 GACAGTAACTAAGACTTCTTT pLKO.1 2070 CDS 100% 5.625 7.875 N CTNNAL1 n/a
4 TRCN0000117274 CCTCTGGAAATAACCTGTATA pLKO.1 1441 CDS 100% 13.200 10.560 N CTNNAL1 n/a
5 TRCN0000424166 AGCTGGCAGCAGATCTATTAA pLKO_005 1265 CDS 100% 15.000 10.500 N CTNNAL1 n/a
6 TRCN0000417065 ACATTGCATCCATCTAGTAAA pLKO_005 1522 CDS 100% 13.200 9.240 N CTNNAL1 n/a
7 TRCN0000117275 GCTTGTATTGAAGCTAAACAA pLKO.1 364 CDS 100% 5.625 3.938 N CTNNAL1 n/a
8 TRCN0000117273 GCTCTCTTAGTCCAACTTCTT pLKO.1 2149 CDS 100% 4.950 3.465 N CTNNAL1 n/a
9 TRCN0000434552 TCAGATCACCACGCTTATTAA pLKO_005 195 CDS 100% 15.000 9.000 N CTNNAL1 n/a
10 TRCN0000117272 CATGTGATGAAGCTGACATTT pLKO.1 2330 3UTR 100% 13.200 7.920 N CTNNAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.