Transcript: Mouse NM_001287101.1

Mus musculus nephronectin (Npnt), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Npnt (114249)
Length:
4763
CDS:
249..2078

Additional Resources:

NCBI RefSeq record:
NM_001287101.1
NBCI Gene record:
Npnt (114249)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001287101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340511 ATTCCACGGCAGCCGACAAAT pLKO_005 1551 CDS 100% 13.200 18.480 N Npnt n/a
2 TRCN0000340450 GAGTCTCCTGCCCTCGATTTA pLKO_005 922 CDS 100% 13.200 18.480 N Npnt n/a
3 TRCN0000340508 ATGCCCGGTGTTACAACATAC pLKO_005 1075 CDS 100% 10.800 15.120 N Npnt n/a
4 TRCN0000119314 GCCCGGTGTTACAACATACAT pLKO.1 1077 CDS 100% 5.625 7.875 N Npnt n/a
5 TRCN0000340449 GTACCACTACACGAGTAATTA pLKO_005 1477 CDS 100% 0.000 0.000 N Npnt n/a
6 TRCN0000340509 GGCCTGACCTCAATCCATATT pLKO_005 2548 3UTR 100% 13.200 10.560 N Npnt n/a
7 TRCN0000119313 GCCAGAAAGAAATGGTACAAT pLKO.1 1199 CDS 100% 5.625 3.938 N Npnt n/a
8 TRCN0000119316 CCAGTACCACTACACGAGTAA pLKO.1 1474 CDS 100% 4.950 3.465 N Npnt n/a
9 TRCN0000119315 GCACAGGTGCATGAACACTTT pLKO.1 695 CDS 100% 4.950 3.465 N Npnt n/a
10 TRCN0000119312 CCCTTCTGATTAAGTAATCAA pLKO.1 3327 3UTR 100% 0.563 0.394 N Npnt n/a
11 TRCN0000055960 GCACAGGTGCATGAACACTTA pLKO.1 695 CDS 100% 4.950 3.465 N NPNT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.