Transcript: Human NM_001287188.2

Homo sapiens ornithine decarboxylase 1 (ODC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ODC1 (4953)
Length:
2376
CDS:
622..1620

Additional Resources:

NCBI RefSeq record:
NM_001287188.2
NBCI Gene record:
ODC1 (4953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344821 ACGGGCGAAAGAGCTAAATAT pLKO_005 780 CDS 100% 15.000 21.000 N ODC1 n/a
2 TRCN0000078434 GCCGACGATCTACTATGTGAT pLKO.1 1440 CDS 100% 4.950 6.930 N ODC1 n/a
3 TRCN0000333415 GCCGACGATCTACTATGTGAT pLKO_005 1440 CDS 100% 4.950 6.930 N ODC1 n/a
4 TRCN0000078436 GCGTCTATGGATCATTTAATT pLKO.1 1196 CDS 100% 15.000 10.500 N ODC1 n/a
5 TRCN0000333342 GCGTCTATGGATCATTTAATT pLKO_005 1196 CDS 100% 15.000 10.500 N ODC1 n/a
6 TRCN0000078435 CCTTGTAAACAAGTATCTCAA pLKO.1 571 5UTR 100% 4.950 3.465 N ODC1 n/a
7 TRCN0000078433 GCCATATGGAAGACTAGGATA pLKO.1 1742 3UTR 100% 0.000 0.000 N ODC1 n/a
8 TRCN0000333344 GCCATATGGAAGACTAGGATA pLKO_005 1742 3UTR 100% 0.000 0.000 N ODC1 n/a
9 TRCN0000078437 CCTCCAGAGAGGATTATCTAT pLKO.1 544 5UTR 100% 5.625 3.375 N ODC1 n/a
10 TRCN0000333413 CCTCCAGAGAGGATTATCTAT pLKO_005 544 5UTR 100% 5.625 3.375 N ODC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.