Transcript: Human NM_001287212.2

Homo sapiens kinesin family member 17 (KIF17), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KIF17 (57576)
Length:
4088
CDS:
729..3518

Additional Resources:

NCBI RefSeq record:
NM_001287212.2
NBCI Gene record:
KIF17 (57576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442616 GTCATCCTCGCTCGAAGAAAC pLKO_005 2048 CDS 100% 10.800 15.120 N KIF17 n/a
2 TRCN0000108345 GAGGCTGTATAGTCCTCCTTA pLKO.1 3712 3UTR 100% 4.950 6.930 N KIF17 n/a
3 TRCN0000108346 CCCGGCTGAAAGCCGACTATA pLKO.1 1681 CDS 100% 4.400 6.160 N KIF17 n/a
4 TRCN0000437040 CAACTGGGCCACAGAACAAAC pLKO_005 3157 CDS 100% 10.800 7.560 N KIF17 n/a
5 TRCN0000432141 GTGTTGGTCTTTGCCTCAAAG pLKO_005 3814 3UTR 100% 10.800 7.560 N KIF17 n/a
6 TRCN0000108347 CCAGCAACTACTTCCGATCTA pLKO.1 3274 CDS 100% 4.950 3.465 N KIF17 n/a
7 TRCN0000108349 CCCAAGGTGGAACCCTCCAAA pLKO.1 2001 CDS 100% 1.650 1.155 N KIF17 n/a
8 TRCN0000108348 CGAGCAGATCTACAACGAGAT pLKO.1 493 5UTR 100% 4.050 2.430 N KIF17 n/a
9 TRCN0000139687 CAAGGACCTGAAGGAGAAGAA pLKO.1 2708 CDS 100% 4.950 2.475 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287212.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.