Transcript: Human NM_001287216.1

Homo sapiens adenosylmethionine decarboxylase 1 (AMD1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AMD1 (262)
Length:
3077
CDS:
323..967

Additional Resources:

NCBI RefSeq record:
NM_001287216.1
NBCI Gene record:
AMD1 (262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344760 GGTTTATGCACAGTGTAATAT pLKO_005 1278 3UTR 100% 15.000 10.500 N AMD1 n/a
2 TRCN0000078461 GATGGAACTTATTGGACTATT pLKO.1 668 CDS 100% 13.200 9.240 N AMD1 n/a
3 TRCN0000333412 GATGGAACTTATTGGACTATT pLKO_005 668 CDS 100% 13.200 9.240 N AMD1 n/a
4 TRCN0000078459 GCCAGATCAAACCTTGGAAAT pLKO.1 478 CDS 100% 10.800 7.560 N AMD1 n/a
5 TRCN0000333411 GCCAGATCAAACCTTGGAAAT pLKO_005 478 CDS 100% 10.800 7.560 N AMD1 n/a
6 TRCN0000114858 CCTTGTTTGTTAATCAGAGTT pLKO.1 810 CDS 100% 4.950 3.465 N Amd2 n/a
7 TRCN0000078460 CGGATGGAACTTATTGGACTA pLKO.1 666 CDS 100% 4.050 2.835 N AMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.