Transcript: Human NM_001287431.1

Homo sapiens ADP ribosylation factor interacting protein 1 (ARFIP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
ARFIP1 (27236)
Length:
2992
CDS:
165..1286

Additional Resources:

NCBI RefSeq record:
NM_001287431.1
NBCI Gene record:
ARFIP1 (27236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061915 CTCGTGAACATAGCTTTAATA pLKO.1 235 CDS 100% 15.000 21.000 N ARFIP1 n/a
2 TRCN0000327667 CTCGTGAACATAGCTTTAATA pLKO_005 235 CDS 100% 15.000 21.000 N ARFIP1 n/a
3 TRCN0000369323 ATGGAGTCTAAACACCTATAA pLKO_005 554 CDS 100% 13.200 18.480 N ARFIP1 n/a
4 TRCN0000061917 CATGGCTTTGACAATACCAAA pLKO.1 315 CDS 100% 4.950 6.930 N ARFIP1 n/a
5 TRCN0000061913 GCGCAATGATGTTTCTGTCAA pLKO.1 1085 CDS 100% 4.950 6.930 N ARFIP1 n/a
6 TRCN0000327669 GCGCAATGATGTTTCTGTCAA pLKO_005 1085 CDS 100% 4.950 6.930 N ARFIP1 n/a
7 TRCN0000312610 CATGAAGAATTTGGCTATAAT pLKO_005 795 CDS 100% 15.000 10.500 N ARFIP1 n/a
8 TRCN0000061914 CCAGTTATTCTAGCAGATGAA pLKO.1 492 CDS 100% 4.950 3.465 N ARFIP1 n/a
9 TRCN0000327668 CCAGTTATTCTAGCAGATGAA pLKO_005 492 CDS 100% 4.950 3.465 N ARFIP1 n/a
10 TRCN0000061916 CCAGGATTGAATATGATGCAT pLKO.1 952 CDS 100% 3.000 2.100 N ARFIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.