Transcript: Human NM_001287499.2

Homo sapiens IQ motif containing E (IQCE), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
IQCE (23288)
Length:
2500
CDS:
204..2312

Additional Resources:

NCBI RefSeq record:
NM_001287499.2
NBCI Gene record:
IQCE (23288)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127910 CAAACTCCAGACCGATATGAA pLKO.1 905 CDS 100% 5.625 3.938 N IQCE n/a
2 TRCN0000275210 CAAACTCCAGACCGATATGAA pLKO_005 905 CDS 100% 5.625 3.938 N IQCE n/a
3 TRCN0000127783 GAAGGTGTACAAGCACAAGAA pLKO.1 1793 CDS 100% 4.950 3.465 N IQCE n/a
4 TRCN0000275266 GAAGGTGTACAAGCACAAGAA pLKO_005 1793 CDS 100% 4.950 3.465 N IQCE n/a
5 TRCN0000130836 GATTCAGACACTTACCAGCAA pLKO.1 1559 CDS 100% 2.640 1.848 N IQCE n/a
6 TRCN0000275267 GATTCAGACACTTACCAGCAA pLKO_005 1559 CDS 100% 2.640 1.848 N IQCE n/a
7 TRCN0000129356 CAAGTTCTGAAACCACCGGAA pLKO.1 1003 CDS 100% 2.160 1.512 N IQCE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287499.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.