Transcript: Human NM_001288725.2

Homo sapiens elongator acetyltransferase complex subunit 4 (ELP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
ELP4 (26610)
Length:
8235
CDS:
19..1449

Additional Resources:

NCBI RefSeq record:
NM_001288725.2
NBCI Gene record:
ELP4 (26610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001283 GCGTTACCAGTTATTACCCAA pLKO.1 504 CDS 100% 2.640 3.696 N ELP4 n/a
2 TRCN0000293280 GCAGATTCCTCGGCTTAATAA pLKO_005 1074 CDS 100% 15.000 12.000 N ELP4 n/a
3 TRCN0000293347 TCAAGATTTGGTCACTATTAT pLKO_005 553 CDS 100% 15.000 10.500 N ELP4 n/a
4 TRCN0000001282 CAGAACTAGCACAGCAGAAAT pLKO.1 1594 3UTR 100% 13.200 9.240 N ELP4 n/a
5 TRCN0000293279 CAGAACTAGCACAGCAGAAAT pLKO_005 1594 3UTR 100% 13.200 9.240 N ELP4 n/a
6 TRCN0000001285 GAGACAAGAGAGGAACATTTA pLKO.1 1185 CDS 100% 13.200 9.240 N ELP4 n/a
7 TRCN0000001284 GAGAGAAACTAACCCATTGTA pLKO.1 1023 CDS 100% 5.625 3.938 N ELP4 n/a
8 TRCN0000293344 GAGAGAAACTAACCCATTGTA pLKO_005 1023 CDS 100% 5.625 3.938 N ELP4 n/a
9 TRCN0000001286 CTCTATGTTCTCCGTGGTCTT pLKO.1 874 CDS 100% 4.050 2.835 N ELP4 n/a
10 TRCN0000293278 CTCTATGTTCTCCGTGGTCTT pLKO_005 874 CDS 100% 4.050 2.835 N ELP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288725.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.