Transcript: Human NM_001289040.2

Homo sapiens PLAG1 like zinc finger 1 (PLAGL1), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PLAGL1 (5325)
Length:
2714
CDS:
355..1590

Additional Resources:

NCBI RefSeq record:
NM_001289040.2
NBCI Gene record:
PLAGL1 (5325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218852 TTTGATCTGGCTAAGGGAAAT pLKO_005 1243 CDS 100% 10.800 15.120 N PLAGL1 n/a
2 TRCN0000230605 CCATCATGCATTCAGATAATT pLKO_005 1572 CDS 100% 15.000 10.500 N PLAGL1 n/a
3 TRCN0000230606 ATCGTAAGCCATGATCATAAT pLKO_005 1890 3UTR 100% 13.200 9.240 N PLAGL1 n/a
4 TRCN0000230604 GATGCTGTGAACCTAACAATA pLKO_005 1300 CDS 100% 13.200 9.240 N PLAGL1 n/a
5 TRCN0000230603 CACACCATCTCGCCTTCATTC pLKO_005 874 CDS 100% 10.800 7.560 N PLAGL1 n/a
6 TRCN0000262362 TGCTACTGGACCACCTCAAAG pLKO_005 599 CDS 100% 10.800 7.560 N PLAGL1 n/a
7 TRCN0000262361 ACACCACTTCTACCTCATACT pLKO_005 1109 CDS 100% 4.950 3.465 N PLAGL1 n/a
8 TRCN0000021235 CAAAGCAGATACTAAAGGTTT pLKO.1 1152 CDS 100% 4.950 3.465 N PLAGL1 n/a
9 TRCN0000021234 CCACTGTGAAAGATGCTTCTA pLKO.1 675 CDS 100% 4.950 3.465 N PLAGL1 n/a
10 TRCN0000021237 CTCGCCTTCATTCCAACTGAA pLKO.1 882 CDS 100% 4.950 3.465 N PLAGL1 n/a
11 TRCN0000021236 GCCTCATTTCCATCATGCATT pLKO.1 1563 CDS 100% 4.950 3.465 N PLAGL1 n/a
12 TRCN0000021238 GAGAAGACGTTCAACCGGAAA pLKO.1 400 CDS 100% 4.050 2.835 N PLAGL1 n/a
13 TRCN0000262359 CAACACCATGCTGGGCTATAA pLKO_005 498 CDS 100% 13.200 7.920 N PLAGL1 n/a
14 TRCN0000262363 CTTTGCTCTGTCTAGCTTAAA pLKO_005 2430 3UTR 100% 13.200 7.920 N PLAGL1 n/a
15 TRCN0000262360 ACTCACAGGAGCTGATGAAAG pLKO_005 818 CDS 100% 10.800 6.480 N PLAGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.