Transcript: Mouse NM_001289526.1

Mus musculus transcription elongation regulator 1 (CA150) (Tcerg1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tcerg1 (56070)
Length:
4397
CDS:
41..3331

Additional Resources:

NCBI RefSeq record:
NM_001289526.1
NBCI Gene record:
Tcerg1 (56070)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085844 CCCGATATAAAGCGGTGGATA pLKO.1 2508 CDS 100% 4.950 6.930 N Tcerg1 n/a
2 TRCN0000014939 GCCAAGAATTTAGACTCAGAA pLKO.1 2576 CDS 100% 4.950 6.930 N TCERG1 n/a
3 TRCN0000413858 GTTCTCAATGAGCGCAATTAA pLKO_005 1786 CDS 100% 15.000 12.000 N Tcerg1 n/a
4 TRCN0000085845 CCTCGGTACTTGCTTCTCAAT pLKO.1 2108 CDS 100% 4.950 3.960 N Tcerg1 n/a
5 TRCN0000429707 GAATGAAGATGAGCCTATTAA pLKO_005 1834 CDS 100% 15.000 10.500 N Tcerg1 n/a
6 TRCN0000427076 AGTTGCACAAGATAGTATTTG pLKO_005 2085 CDS 100% 13.200 9.240 N Tcerg1 n/a
7 TRCN0000085847 GCAGTTTCTGAGTGGACTGAA pLKO.1 1274 CDS 100% 4.950 3.465 N Tcerg1 n/a
8 TRCN0000085843 GCCTATGTTGATGACCTGGAT pLKO.1 3251 CDS 100% 2.640 1.848 N Tcerg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.