Transcript: Mouse NM_001289564.1

Mus musculus relaxin/insulin-like family peptide receptor 2 (Rxfp2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-12
Taxon:
Mus musculus (mouse)
Gene:
Rxfp2 (140498)
Length:
3317
CDS:
194..2335

Additional Resources:

NCBI RefSeq record:
NM_001289564.1
NBCI Gene record:
Rxfp2 (140498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241538 ATCAGCTTGCTTGGCTAATTT pLKO_005 768 CDS 100% 15.000 21.000 N Rxfp2 n/a
2 TRCN0000217275 CGTTCACCAGAGAGGATTATT pLKO.1 1737 CDS 100% 15.000 21.000 N Rxfp2 n/a
3 TRCN0000241540 TCCGGTGAACAGCGCCTTAAA pLKO_005 2110 CDS 100% 13.200 18.480 N Rxfp2 n/a
4 TRCN0000215516 GAAGTTCCTTGTCATAGTATT pLKO.1 1627 CDS 100% 13.200 10.560 N Rxfp2 n/a
5 TRCN0000176238 GAATGTGTAAAGGCTGACTTA pLKO.1 509 CDS 100% 4.950 3.960 N Rxfp2 n/a
6 TRCN0000241539 AGTGGATGGACAACCATATTT pLKO_005 392 CDS 100% 15.000 10.500 N Rxfp2 n/a
7 TRCN0000241541 TGCCGTCGACTGATGGTATTT pLKO_005 1269 CDS 100% 13.200 9.240 N Rxfp2 n/a
8 TRCN0000194580 CCTGTGGGAATCTCACCAAAT pLKO.1 294 CDS 100% 10.800 7.560 N Rxfp2 n/a
9 TRCN0000009005 CGAGGGCAGTATCAGAAGTAT pLKO.1 1505 CDS 100% 5.625 3.938 N RXFP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.