Transcript: Mouse NM_001289578.1

Mus musculus checkpoint with forkhead and ring finger domains (Chfr), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Chfr (231600)
Length:
2964
CDS:
117..1895

Additional Resources:

NCBI RefSeq record:
NM_001289578.1
NBCI Gene record:
Chfr (231600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124630 CGCAGTTCACTTGTTGCAAAT pLKO.1 552 CDS 100% 10.800 15.120 N Chfr n/a
2 TRCN0000124631 GAATCGGACATCCTGAAGAAT pLKO.1 1566 CDS 100% 5.625 7.875 N Chfr n/a
3 TRCN0000124632 CAGCACCAATGGAACAGTGAT pLKO.1 347 CDS 100% 4.950 6.930 N Chfr n/a
4 TRCN0000124629 GCCATGTCATCTGGAATAATA pLKO.1 2730 3UTR 100% 15.000 10.500 N Chfr n/a
5 TRCN0000124633 CCAATGGAACAGTGATCAATA pLKO.1 352 CDS 100% 13.200 9.240 N Chfr n/a
6 TRCN0000007705 GCATACCTCTATGAATCTTTA pLKO.1 465 CDS 100% 13.200 9.240 N CHFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289578.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.