Transcript: Mouse NM_001289590.1

Mus musculus zinc finger protein 12 (Zfp12), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Zfp12 (231866)
Length:
5346
CDS:
588..2396

Additional Resources:

NCBI RefSeq record:
NM_001289590.1
NBCI Gene record:
Zfp12 (231866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246179 CATTATCAAACCGGATGTTAT pLKO_005 485 5UTR 100% 13.200 18.480 N ZNF12 n/a
2 TRCN0000096355 CGGGCGTCAAACTCTACAAAT pLKO.1 1528 CDS 100% 13.200 9.240 N Zfp12 n/a
3 TRCN0000096358 GAATACGTTGAGTGCCAGAAA pLKO.1 969 CDS 100% 4.950 3.465 N Zfp12 n/a
4 TRCN0000096357 GCCTCTAGTAAGGCCACTGAT pLKO.1 672 CDS 100% 4.950 3.465 N Zfp12 n/a
5 TRCN0000096354 GCTAGAAATAAGTACACTCTA pLKO.1 3234 3UTR 100% 4.950 3.465 N Zfp12 n/a
6 TRCN0000096356 CCAGATGTCTTATCTCACTAT pLKO.1 2162 CDS 100% 4.950 2.970 N Zfp12 n/a
7 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 3125 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
8 TRCN0000226239 GAGAAGCCCTTCGAGTGTAAT pLKO_005 2205 CDS 100% 13.200 6.600 Y LOC676710 n/a
9 TRCN0000434057 GAGAAGCCCTACGAGTGTAAC pLKO_005 1281 CDS 100% 10.800 5.400 Y Zfp647 n/a
10 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 3086 3UTR 100% 2.640 1.320 Y Adsl n/a
11 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 3086 3UTR 100% 2.640 1.320 Y Adsl n/a
12 TRCN0000226240 GAGAAGCCCTACGAGTGTAAT pLKO_005 1281 CDS 100% 13.200 6.600 Y LOC676710 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289590.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.