Transcript: Mouse NM_001289601.1

Mus musculus platelet endothelial aggregation receptor 1 (Pear1), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pear1 (73182)
Length:
4510
CDS:
1113..3461

Additional Resources:

NCBI RefSeq record:
NM_001289601.1
NBCI Gene record:
Pear1 (73182)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304912 TTTAGAGGGAGTCAGGTATAG pLKO_005 3775 3UTR 100% 10.800 15.120 N Pear1 n/a
2 TRCN0000311154 CACTGTGCTCCTGGCTATATC pLKO_005 1224 CDS 100% 13.200 9.240 N Pear1 n/a
3 TRCN0000119486 GCCCGTTGCTTTCCTGCTAAT pLKO.1 1323 CDS 100% 10.800 7.560 N Pear1 n/a
4 TRCN0000316472 GCCCGTTGCTTTCCTGCTAAT pLKO_005 1323 CDS 100% 10.800 7.560 N Pear1 n/a
5 TRCN0000119484 GACCCAACTGTACTCAGGAAT pLKO.1 1156 CDS 100% 4.950 3.465 N Pear1 n/a
6 TRCN0000316403 GACCCAACTGTACTCAGGAAT pLKO_005 1156 CDS 100% 4.950 3.465 N Pear1 n/a
7 TRCN0000119483 GCAATGCAAGTGTAACAACAA pLKO.1 2210 CDS 100% 4.950 3.465 N Pear1 n/a
8 TRCN0000316473 GCAATGCAAGTGTAACAACAA pLKO_005 2210 CDS 100% 4.950 3.465 N Pear1 n/a
9 TRCN0000119482 CGCTTCATTCTTTCCCAGAAT pLKO.1 3999 3UTR 100% 0.495 0.347 N Pear1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.