Transcript: Mouse NM_001289896.1

Mus musculus thrombopoietin (Thpo), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Thpo (21832)
Length:
2065
CDS:
238..945

Additional Resources:

NCBI RefSeq record:
NM_001289896.1
NBCI Gene record:
Thpo (21832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066843 CCCAGTCCAAATCTCTGGATA pLKO.1 760 CDS 100% 4.950 3.465 N Thpo n/a
2 TRCN0000301751 CCCAGTCCAAATCTCTGGATA pLKO_005 760 CDS 100% 4.950 3.465 N Thpo n/a
3 TRCN0000066846 CCCTTTGTCTATCCCTGTTCT pLKO.1 399 CDS 100% 4.950 3.465 N Thpo n/a
4 TRCN0000301815 CCCTTTGTCTATCCCTGTTCT pLKO_005 399 CDS 100% 4.950 3.465 N Thpo n/a
5 TRCN0000066847 GCTTCAGGGATTCAGAGTCAA pLKO.1 703 CDS 100% 4.950 3.465 N Thpo n/a
6 TRCN0000331570 GCTTCAGGGATTCAGAGTCAA pLKO_005 703 CDS 100% 4.950 3.465 N Thpo n/a
7 TRCN0000066844 CCAGTCACAATGTACCCTCAT pLKO.1 1064 3UTR 100% 4.050 2.835 N Thpo n/a
8 TRCN0000301753 CCAGTCACAATGTACCCTCAT pLKO_005 1064 3UTR 100% 4.050 2.835 N Thpo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.