Transcript: Mouse NM_001290011.1

Mus musculus phosphatidylethanolamine N-methyltransferase (Pemt), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pemt (18618)
Length:
989
CDS:
55..765

Additional Resources:

NCBI RefSeq record:
NM_001290011.1
NBCI Gene record:
Pemt (18618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313023 TTGACGGTGCTGGTGGCAATT pLKO_005 658 CDS 100% 10.800 15.120 N Pemt n/a
2 TRCN0000313022 ACGTGGTTGCTCTCCTATATG pLKO_005 683 CDS 100% 13.200 10.560 N Pemt n/a
3 TRCN0000097472 GACCTTTCTAGGTGACTACTT pLKO.1 510 CDS 100% 4.950 3.960 N Pemt n/a
4 TRCN0000312024 GACCTTTCTAGGTGACTACTT pLKO_005 510 CDS 100% 4.950 3.960 N Pemt n/a
5 TRCN0000097470 GCTGAGATCTACCGACAGAAA pLKO.1 718 CDS 100% 4.950 3.960 N Pemt n/a
6 TRCN0000097471 TGGGACCTTTCTAGGTGACTA pLKO.1 507 CDS 100% 4.950 3.960 N Pemt n/a
7 TRCN0000313024 GAGTCCAGAGTGACCACATTT pLKO_005 544 CDS 100% 13.200 9.240 N Pemt n/a
8 TRCN0000312978 CAGGGCCATGAAGGATCTTTG pLKO_005 766 CDS 100% 10.800 7.560 N Pemt n/a
9 TRCN0000097473 CATTGTGTTCAACCCACTCTT pLKO.1 228 CDS 100% 4.950 3.465 N Pemt n/a
10 TRCN0000097469 GCCATGAAGGATCTTTGGAAA pLKO.1 770 3UTR 100% 4.950 3.465 N Pemt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.