Transcript: Human NM_001290228.2

Homo sapiens microtubule associated serine/threonine kinase family member 4 (MAST4), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
MAST4 (375449)
Length:
1017
CDS:
264..980

Additional Resources:

NCBI RefSeq record:
NM_001290228.2
NBCI Gene record:
MAST4 (375449)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037874 GAGGAGCTTGACCACATATTA pLKO.1 621 CDS 100% 15.000 21.000 N MAST4 n/a
2 TRCN0000195364 CGAGGAGCTTGACCACATATT pLKO.1 620 CDS 100% 13.200 18.480 N MAST4 n/a
3 TRCN0000199153 CCCATGCCGTTTCGGAAATGC pLKO.1 651 CDS 100% 1.650 2.310 N MAST4 n/a
4 TRCN0000037876 TCAGAAACTCTGTCGGAGGAA pLKO.1 396 CDS 100% 2.640 1.848 N MAST4 n/a
5 TRCN0000199506 GACTCCAGCCTCTGCGCTGGT pLKO.1 329 CDS 100% 0.000 0.000 N MAST4 n/a
6 TRCN0000037877 GTGAGGATGGAAGACAGCTAA pLKO.1 730 CDS 100% 4.950 2.970 N MAST4 n/a
7 TRCN0000199676 GACAGCTGAGTGAGGATGGAA pLKO.1 721 CDS 100% 3.000 1.800 N MAST4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.