Transcript: Human NM_001290404.1

Homo sapiens TAL bHLH transcription factor 1, erythroid differentiation factor (TAL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TAL1 (6886)
Length:
4779
CDS:
332..1327

Additional Resources:

NCBI RefSeq record:
NM_001290404.1
NBCI Gene record:
TAL1 (6886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431584 ACCAAAGTTGTGCGGCGTATC pLKO_005 881 CDS 100% 6.000 8.400 N TAL1 n/a
2 TRCN0000413816 TGCGGCGTATCTTCACCAACA pLKO_005 891 CDS 100% 4.050 5.670 N TAL1 n/a
3 TRCN0000014692 CCTGCTGAACGGCGTCGCCAA pLKO.1 427 CDS 100% 0.000 0.000 N TAL1 n/a
4 TRCN0000014689 CCCTATGTTCACCACCAACAA pLKO.1 805 CDS 100% 4.950 3.960 N TAL1 n/a
5 TRCN0000014688 GCCCAGCATTTGGGTAATTTA pLKO.1 3554 3UTR 100% 15.000 10.500 N TAL1 n/a
6 TRCN0000418493 GCCTGGCCATGAAGTATATCA pLKO_005 1020 CDS 100% 5.625 3.938 N TAL1 n/a
7 TRCN0000014691 CACCACCAACAATCGAGTGAA pLKO.1 814 CDS 100% 4.950 3.465 N TAL1 n/a
8 TRCN0000430871 CCTATGAGATGGAGATTACTG pLKO_005 849 CDS 100% 4.950 3.465 N TAL1 n/a
9 TRCN0000014690 GCTCAGCAAGAATGAGATCCT pLKO.1 997 CDS 100% 2.640 1.848 N TAL1 n/a
10 TRCN0000413099 CAAGCTGCTCAATGACCAGGA pLKO_005 1051 CDS 100% 2.160 1.512 N TAL1 n/a
11 TRCN0000421967 CAATCGAGTGAAGAGGAGACC pLKO_005 823 CDS 100% 2.160 1.512 N TAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.