Transcript: Human NM_001290406.2

Homo sapiens TAL bHLH transcription factor 1, erythroid differentiation factor (TAL1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TAL1 (6886)
Length:
4038
CDS:
91..609

Additional Resources:

NCBI RefSeq record:
NM_001290406.2
NBCI Gene record:
TAL1 (6886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431584 ACCAAAGTTGTGCGGCGTATC pLKO_005 163 CDS 100% 6.000 8.400 N TAL1 n/a
2 TRCN0000413816 TGCGGCGTATCTTCACCAACA pLKO_005 173 CDS 100% 4.050 5.670 N TAL1 n/a
3 TRCN0000014689 CCCTATGTTCACCACCAACAA pLKO.1 87 5UTR 100% 4.950 3.960 N TAL1 n/a
4 TRCN0000014688 GCCCAGCATTTGGGTAATTTA pLKO.1 2836 3UTR 100% 15.000 10.500 N TAL1 n/a
5 TRCN0000418493 GCCTGGCCATGAAGTATATCA pLKO_005 302 CDS 100% 5.625 3.938 N TAL1 n/a
6 TRCN0000014691 CACCACCAACAATCGAGTGAA pLKO.1 96 CDS 100% 4.950 3.465 N TAL1 n/a
7 TRCN0000430871 CCTATGAGATGGAGATTACTG pLKO_005 131 CDS 100% 4.950 3.465 N TAL1 n/a
8 TRCN0000014690 GCTCAGCAAGAATGAGATCCT pLKO.1 279 CDS 100% 2.640 1.848 N TAL1 n/a
9 TRCN0000413099 CAAGCTGCTCAATGACCAGGA pLKO_005 333 CDS 100% 2.160 1.512 N TAL1 n/a
10 TRCN0000421967 CAATCGAGTGAAGAGGAGACC pLKO_005 105 CDS 100% 2.160 1.512 N TAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.