Transcript: Mouse NM_001290410.1

Mus musculus Na+/K+ transporting ATPase interacting 3 (Nkain3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Nkain3 (269513)
Length:
4668
CDS:
354..899

Additional Resources:

NCBI RefSeq record:
NM_001290410.1
NBCI Gene record:
Nkain3 (269513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181852 GCATGATGGATGACTACACAT pLKO.1 727 CDS 100% 4.950 6.930 N Nkain3 n/a
2 TRCN0000198529 GCGCTGTACAAATACTGCTAT pLKO.1 802 CDS 100% 4.950 3.960 N Nkain3 n/a
3 TRCN0000176642 CTTGGAAATTTCCTGCATATA pLKO.1 465 CDS 100% 13.200 9.240 N Nkain3 n/a
4 TRCN0000431252 ACGTTACATCATGGTGTATAC pLKO_005 530 CDS 100% 10.800 7.560 N Nkain3 n/a
5 TRCN0000181953 GTTGTCGATTTCCAGTACCTA pLKO.1 768 CDS 100% 3.000 2.100 N Nkain3 n/a
6 TRCN0000420434 TTGTCATATTGGGTCTGTTTG pLKO_005 490 CDS 100% 10.800 6.480 N Nkain3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.