Transcript: Mouse NM_001290501.1

Mus musculus zinc and ring finger 3 (Znrf3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Znrf3 (407821)
Length:
7199
CDS:
305..2734

Additional Resources:

NCBI RefSeq record:
NM_001290501.1
NBCI Gene record:
Znrf3 (407821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254179 CGTCAGATGGCCCAGTTATTT pLKO_005 5631 3UTR 100% 15.000 21.000 N Znrf3 n/a
2 TRCN0000254177 AGTGACCCTACCGGTACATTA pLKO_005 1090 CDS 100% 13.200 18.480 N Znrf3 n/a
3 TRCN0000265494 GTCTTCACTCAGACCATTATC pLKO_005 2238 CDS 100% 13.200 18.480 N Znrf3 n/a
4 TRCN0000254176 GACAACCCACCGAGTACTTTG pLKO_005 639 CDS 100% 10.800 15.120 N Znrf3 n/a
5 TRCN0000253790 ACTGTCGGCACAACATCATAG pLKO_005 1002 CDS 100% 10.800 7.560 N ZNRF3 n/a
6 TRCN0000254178 CTGCTACACTGAGGACTATTC pLKO_005 2347 CDS 100% 10.800 7.560 N Znrf3 n/a
7 TRCN0000253791 ATGACGAAGAGGACTTGTATG pLKO_005 336 CDS 100% 10.800 6.480 N ZNRF3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3882 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.