Transcript: Mouse NM_001290573.1

Mus musculus lysine (K)-specific methyltransferase 2B (Kmt2b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Kmt2b (75410)
Length:
8484
CDS:
10..8178

Additional Resources:

NCBI RefSeq record:
NM_001290573.1
NBCI Gene record:
Kmt2b (75410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034405 CCGGAAGTGTACCTTTGACAT pLKO.1 7578 CDS 100% 4.950 6.930 N Kmt2b n/a
2 TRCN0000034407 CGGTGCCGAATTCTAGAGTAT pLKO.1 5356 CDS 100% 0.000 0.000 N Kmt2b n/a
3 TRCN0000427977 ACCAATGCTCCCGCCTGTATT pLKO_005 5300 CDS 100% 13.200 10.560 N Kmt2b n/a
4 TRCN0000416389 AGAATATACGGCAGTTTATTA pLKO_005 1604 CDS 100% 15.000 10.500 N Kmt2b n/a
5 TRCN0000034408 CCCTTATGATCAAGTTTGTTT pLKO.1 914 CDS 100% 5.625 3.938 N Kmt2b n/a
6 TRCN0000034404 AGTCTCAGTATCTCACTCCTA pLKO.1 8241 3UTR 100% 2.640 1.848 N Kmt2b n/a
7 TRCN0000034406 GCCTTCAGAAATTGTGGATTT pLKO.1 6351 CDS 100% 10.800 6.480 N Kmt2b n/a
8 TRCN0000005960 CGCATGGATGACTTTGATGTA pLKO.1 7924 CDS 100% 4.950 3.465 N KMT2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290573.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.