Transcript: Mouse NM_001290623.1

Mus musculus equatorin, sperm acrosome associated (Eqtn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Eqtn (67753)
Length:
1164
CDS:
92..982

Additional Resources:

NCBI RefSeq record:
NM_001290623.1
NBCI Gene record:
Eqtn (67753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215983 CACCGAGTAATTAACTATAAG pLKO.1 969 CDS 100% 13.200 18.480 N Eqtn n/a
2 TRCN0000216711 CCTAGTGAATCCTCTCGTAAA pLKO.1 452 CDS 100% 10.800 15.120 N Eqtn n/a
3 TRCN0000198847 CCCAGACATTATCAGTCTACA pLKO.1 133 CDS 100% 4.950 6.930 N Eqtn n/a
4 TRCN0000198512 GCCACAACTAACCTGGAATTT pLKO.1 374 CDS 100% 13.200 10.560 N Eqtn n/a
5 TRCN0000178268 GCTCCAATCAAACAGTCTTAA pLKO.1 807 CDS 100% 13.200 10.560 N Eqtn n/a
6 TRCN0000177126 GCATGGATGATAAAGATCAAT pLKO.1 540 CDS 100% 5.625 3.938 N Eqtn n/a
7 TRCN0000177362 GAACAGTATTATGCAGATGAA pLKO.1 197 CDS 100% 4.950 3.465 N Eqtn n/a
8 TRCN0000177697 CTCTATCTTACTTCCATCCAA pLKO.1 780 CDS 100% 3.000 2.100 N Eqtn n/a
9 TRCN0000176897 GCTGTGAAGAAGAACTATAAA pLKO.1 395 CDS 100% 15.000 9.000 N Eqtn n/a
10 TRCN0000181244 CCTGGAATTTGCTGTGAAGAA pLKO.1 385 CDS 100% 4.950 2.970 N Eqtn n/a
11 TRCN0000176721 CTTTCAGATGAAGAACAGTAT pLKO.1 185 CDS 100% 4.950 2.970 N Eqtn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.