Transcript: Mouse NM_001290630.1

Mus musculus RNA binding motif protein 41 (Rbm41), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rbm41 (237073)
Length:
5611
CDS:
89..1402

Additional Resources:

NCBI RefSeq record:
NM_001290630.1
NBCI Gene record:
Rbm41 (237073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250028 ACCTTAGTCCTCGGGTGAAAG pLKO_005 1104 CDS 100% 10.800 15.120 N Rbm41 n/a
2 TRCN0000250027 TCAGCGCTCTTCCCTTATAAC pLKO_005 1342 CDS 100% 13.200 10.560 N Rbm41 n/a
3 TRCN0000192771 CGTCTTGAAGAGTTCCAACTT pLKO.1 761 CDS 100% 4.950 3.960 N Rbm41 n/a
4 TRCN0000200606 CCAATAGAATTTATCCCAGAA pLKO.1 980 CDS 100% 4.050 3.240 N Rbm41 n/a
5 TRCN0000250026 GAAACGGCTTGAAGATATTAA pLKO_005 442 CDS 100% 15.000 10.500 N Rbm41 n/a
6 TRCN0000257979 TTCCCTAGTGATTCGTTTATA pLKO_005 2389 3UTR 100% 15.000 10.500 N Rbm41 n/a
7 TRCN0000215606 GAAAGAGACCTTATCTCATTA pLKO.1 1124 CDS 100% 13.200 9.240 N Rbm41 n/a
8 TRCN0000257990 GAACCAAACAAGGTGCTATAT pLKO_005 1076 CDS 100% 13.200 9.240 N Rbm41 n/a
9 TRCN0000201194 GCAATACAGAAACGGCTTGAA pLKO.1 434 CDS 100% 4.950 3.465 N Rbm41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290630.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.