Transcript: Mouse NM_001290660.1

Mus musculus CD302 antigen (Cd302), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cd302 (66205)
Length:
1363
CDS:
365..1051

Additional Resources:

NCBI RefSeq record:
NM_001290660.1
NBCI Gene record:
Cd302 (66205)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175148 GCATATTGAATCCATTGACAA pLKO.1 1073 3UTR 100% 4.950 3.960 N Cd302 n/a
2 TRCN0000320307 GCATATTGAATCCATTGACAA pLKO_005 1073 3UTR 100% 4.950 3.960 N Cd302 n/a
3 TRCN0000194075 GCAACTTTCAAGTGGTATGAT pLKO.1 656 CDS 100% 5.625 3.938 N Cd302 n/a
4 TRCN0000173723 CCTAGTTGATACCTGTGGTTT pLKO.1 724 CDS 100% 4.950 3.465 N Cd302 n/a
5 TRCN0000320305 CCTAGTTGATACCTGTGGTTT pLKO_005 724 CDS 100% 4.950 3.465 N Cd302 n/a
6 TRCN0000194122 GACATGGTAAGCATACACAAT pLKO.1 542 CDS 100% 4.950 3.465 N Cd302 n/a
7 TRCN0000194036 GATGCAACTTTCAAGTGGTAT pLKO.1 653 CDS 100% 4.950 3.465 N Cd302 n/a
8 TRCN0000176008 GTAGTTGCAGAAGAAGATGAA pLKO.1 1010 CDS 100% 4.950 3.465 N Cd302 n/a
9 TRCN0000320233 GTAGTTGCAGAAGAAGATGAA pLKO_005 1010 CDS 100% 4.950 3.465 N Cd302 n/a
10 TRCN0000194037 GCAGAAGAAGATGAATATGCT pLKO.1 1016 CDS 100% 3.000 2.100 N Cd302 n/a
11 TRCN0000174367 CCATTGACAATAATTTCCTGT pLKO.1 1084 3UTR 100% 2.640 1.848 N Cd302 n/a
12 TRCN0000320235 CCATTGACAATAATTTCCTGT pLKO_005 1084 3UTR 100% 2.640 1.848 N Cd302 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290660.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.