Transcript: Mouse NM_001290820.1

Mus musculus zinc finger SCAN domains 29 (Zscan29), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zscan29 (99334)
Length:
2409
CDS:
1115..2038

Additional Resources:

NCBI RefSeq record:
NM_001290820.1
NBCI Gene record:
Zscan29 (99334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430485 AGCTGGGAGGCTTCGTGAATA pLKO_005 1621 CDS 100% 13.200 9.240 N Zscan29 n/a
2 TRCN0000085029 AGGTCATTTCATTGCCCATTA pLKO.1 1776 CDS 100% 10.800 7.560 N Zscan29 n/a
3 TRCN0000085031 CAGGAACCAGTCTATTACCAT pLKO.1 1422 CDS 100% 3.000 2.100 N Zscan29 n/a
4 TRCN0000085032 CCAGGTCATTTCATTGCCCAT pLKO.1 1774 CDS 100% 2.160 1.512 N Zscan29 n/a
5 TRCN0000085030 CCCTTCTTTGAAGAGATGGAA pLKO.1 1739 CDS 100% 3.000 1.800 N Zscan29 n/a
6 TRCN0000085028 CCCTTGAGCTACACCTCAAAT pLKO.1 2224 3UTR 100% 1.320 0.792 N Zscan29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290820.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.