Transcript: Mouse NM_001290825.1

Mus musculus collagen, type XVII, alpha 1 (Col17a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Col17a1 (12821)
Length:
5539
CDS:
242..4654

Additional Resources:

NCBI RefSeq record:
NM_001290825.1
NBCI Gene record:
Col17a1 (12821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094531 CCGAGAGAATTGTCACGGAAA pLKO.1 285 CDS 100% 4.050 3.240 N Col17a1 n/a
2 TRCN0000094530 GCAGACACATTCTCAACTATA pLKO.1 3594 CDS 100% 13.200 9.240 N Col17a1 n/a
3 TRCN0000094529 CCTTTGTAGATGACGTGTGAT pLKO.1 5022 3UTR 100% 4.950 3.465 N Col17a1 n/a
4 TRCN0000094532 CGGAACCTATGATTCAGCAAT pLKO.1 856 CDS 100% 4.950 3.465 N Col17a1 n/a
5 TRCN0000094533 CCTGACTGACTCAGAAACCTT pLKO.1 3028 CDS 100% 3.000 2.100 N Col17a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290825.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.