Transcript: Mouse NM_001291012.1

Mus musculus nephronophthisis 1 (juvenile) homolog (human) (Nphp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Nphp1 (53885)
Length:
2300
CDS:
38..2110

Additional Resources:

NCBI RefSeq record:
NM_001291012.1
NBCI Gene record:
Nphp1 (53885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192281 CCTGCAAAGTGCCGATTTAAT pLKO.1 1705 CDS 100% 15.000 21.000 N Nphp1 n/a
2 TRCN0000292553 CCTGCAAAGTGCCGATTTAAT pLKO_005 1705 CDS 100% 15.000 21.000 N Nphp1 n/a
3 TRCN0000201440 CAGGAAGACTTGCCTCAAACA pLKO.1 2152 3UTR 100% 4.950 3.465 N Nphp1 n/a
4 TRCN0000292551 CAGGAAGACTTGCCTCAAACA pLKO_005 2152 3UTR 100% 4.950 3.465 N Nphp1 n/a
5 TRCN0000200670 GTTGATAGTTTGGTGACTGAA pLKO.1 107 CDS 100% 4.950 3.465 N Nphp1 n/a
6 TRCN0000292552 GTTGATAGTTTGGTGACTGAA pLKO_005 107 CDS 100% 4.950 3.465 N Nphp1 n/a
7 TRCN0000190911 CCCGAAACAAGCAGAAACAGA pLKO.1 484 CDS 100% 3.000 2.100 N Nphp1 n/a
8 TRCN0000298008 CCCGAAACAAGCAGAAACAGA pLKO_005 484 CDS 100% 3.000 2.100 N Nphp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291012.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.