Transcript: Mouse NM_001291014.1

Mus musculus zinc finger with KRAB and SCAN domains 17 (Zkscan17), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Zkscan17 (268417)
Length:
3781
CDS:
932..2221

Additional Resources:

NCBI RefSeq record:
NM_001291014.1
NBCI Gene record:
Zkscan17 (268417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084369 CCGTAGACACTGTCATCTAAA pLKO.1 2077 CDS 100% 13.200 18.480 N Zkscan17 n/a
2 TRCN0000424514 GACGACAGACCTCCAGGATAA pLKO_005 1309 CDS 100% 10.800 7.560 N Zkscan17 n/a
3 TRCN0000423398 TGCTCTCAGGTAGTGTCTAAC pLKO_005 2283 3UTR 100% 10.800 7.560 N Zkscan17 n/a
4 TRCN0000084372 GTGCCCAAACTGTGGAAAGAT pLKO.1 1681 CDS 100% 5.625 3.938 N Zkscan17 n/a
5 TRCN0000084371 CACCGTAGACACTGTCATCTA pLKO.1 2075 CDS 100% 4.950 3.465 N Zkscan17 n/a
6 TRCN0000084370 GAAGACTTAGTTCCGCAAGAT pLKO.1 1025 CDS 100% 4.950 3.465 N Zkscan17 n/a
7 TRCN0000084368 CCAGGGAGAATCTTCATCCAT pLKO.1 3357 3UTR 100% 3.000 2.100 N Zkscan17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.