Transcript: Mouse NM_001291015.1

Mus musculus MGAT4 family, member E (Mgat4e), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mgat4e (71001)
Length:
1832
CDS:
715..1788

Additional Resources:

NCBI RefSeq record:
NM_001291015.1
NBCI Gene record:
Mgat4e (71001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093763 GTGGAACTGTTTACACGGATA pLKO.1 1310 CDS 100% 4.050 5.670 N Mgat4e n/a
2 TRCN0000093761 GTATAAAGTAAGCTGCGTGAA pLKO.1 1626 CDS 100% 4.050 3.240 N Mgat4e n/a
3 TRCN0000430028 TTTGAGAACAAGACCTTAATA pLKO_005 1252 CDS 100% 15.000 10.500 N Mgat4e n/a
4 TRCN0000418716 CCACTTACTTCCTCTTGATAG pLKO_005 950 CDS 100% 10.800 7.560 N Mgat4e n/a
5 TRCN0000093762 TGGTCTCATGATCAGGCATAT pLKO.1 1674 CDS 100% 10.800 7.560 N Mgat4e n/a
6 TRCN0000093759 CGAGTTCTCTAATATGGGCTT pLKO.1 1056 CDS 100% 2.160 1.512 N Mgat4e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.