Transcript: Mouse NM_001291105.1

Mus musculus E2F transcription factor 1 (E2f1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
E2f1 (13555)
Length:
2695
CDS:
250..1407

Additional Resources:

NCBI RefSeq record:
NM_001291105.1
NBCI Gene record:
E2f1 (13555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349751 ACGCTATGAAACCTCACTAAA pLKO_005 477 CDS 100% 13.200 18.480 N E2f1 n/a
2 TRCN0000042620 CGCTATGAAACCTCACTAAAT pLKO.1 478 CDS 100% 13.200 18.480 N E2f1 n/a
3 TRCN0000042622 GCCCTTGACTATCACTTTGGT pLKO.1 1315 CDS 100% 3.000 2.400 N E2f1 n/a
4 TRCN0000374127 CTCACTCCTGGAGCATGTTAA pLKO_005 1236 CDS 100% 13.200 9.240 N E2f1 n/a
5 TRCN0000312760 AGGCCCTTGACTATCACTTTG pLKO_005 1313 CDS 100% 10.800 7.560 N E2f1 n/a
6 TRCN0000312761 CCATACCCTCTGTCCCAATAG pLKO_005 1510 3UTR 100% 10.800 7.560 N E2f1 n/a
7 TRCN0000374126 CTGCAGAACAGATGGTCATAG pLKO_005 869 CDS 100% 10.800 7.560 N E2f1 n/a
8 TRCN0000042619 GCCAAGAAGTCCAAGAATCAT pLKO.1 640 CDS 100% 5.625 3.938 N E2f1 n/a
9 TRCN0000311777 GCCAAGAAGTCCAAGAATCAT pLKO_005 640 CDS 100% 5.625 3.938 N E2f1 n/a
10 TRCN0000042618 CCCAACTACAAGCTGTGGATT pLKO.1 911 CDS 100% 4.950 3.465 N E2f1 n/a
11 TRCN0000042621 GATCTCTTTGACTGTGACTTT pLKO.1 1360 CDS 100% 4.950 3.465 N E2f1 n/a
12 TRCN0000000251 CATCCAGCTCATTGCCAAGAA pLKO.1 627 CDS 100% 4.950 2.970 N E2F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.